microRNA name: miR-86 WormBase ID: WBGene00003314 WormBase description of miR-86: Expressed in dorsal nerve cord; nerve ring; tail neurons; and ventral nerve cord. Conserved microRNA sequences of miR-86: D.melanogaster: dme-miR-987 H.sapiens: hsa-miR-545*, hsa-miR-559 Location: intron sense |
Promoter length (bp): 2000 Promoter sequence: "atcaaaccgtgatgggaaagtccacgttgtgtcagtctgtcttaataaagtttgatctacaaaaattgcgggattttttt Restriction site: ApaI/SacII |
Tissue specificity (embryo): Tissue specificity (L1): |
Number of insertion lines: 6 All strain names: SYS2271, SYS2272, SYS2273, SYS2274, SYS2275, SYS2276 Representative strain name: SYS2271 |
600-cell stage and L1 stage |
Embryonic 3D expression pattern 4-cell 8-cell 15-cell 28-cell ~50-cell ~100-cell ~200-cell ~350-cell ~500-cell ~600-cell 600-cell bean-stage |
L1 3D expression pattern |
► Lineage expression pattern of all strains until 350-cell stage |