| microRNA name: miR-86 WormBase ID: WBGene00003314 WormBase description of miR-86: Expressed in dorsal nerve cord; nerve ring; tail neurons; and ventral nerve cord. Conserved microRNA sequences of miR-86: D.melanogaster: dme-miR-987 H.sapiens: hsa-miR-545*, hsa-miR-559 Location: intron sense | 
| Promoter length (bp):  2000 Promoter sequence: "atcaaaccgtgatgggaaagtccacgttgtgtcagtctgtcttaataaagtttgatctacaaaaattgcgggattttttt Restriction site: ApaI/SacII | 
| Tissue specificity (embryo): Tissue specificity (L1): | 
| Number of insertion lines: 6 All strain names: SYS2271, SYS2272, SYS2273, SYS2274, SYS2275, SYS2276 Representative strain name: SYS2271 | 
| 600-cell stage and L1 stage   | 
| Embryonic 3D expression pattern  4-cell  8-cell  15-cell  28-cell  ~50-cell  ~100-cell  ~200-cell  ~350-cell  ~500-cell  ~600-cell  600-cell  bean-stage | 
| L1 3D expression pattern | 
| ► Lineage expression pattern of all strains until 350-cell stage |